What method did Miescher use to extract nuclei?
Click to see answer
He used alkali to extract the nuclei.
Click to see question
What method did Miescher use to extract nuclei?
He used alkali to extract the nuclei.
How are phage genes described during the time the prophage is replicated?
They are inactive or repressed.
What is the typical length range of satellite DNA?
From 105 to 107 bp.
What does a relaxed molecule of DNA indicate?
It indicates that the DNA is not under torsional strain.
What is the typical structure of plasmids?
Most plasmids are supercoiled, giving them a condensed, compact form.
How many times does DNA wrap around the histone octamer?
Roughly 1.7 times.
What substance did Miescher discover while isolating nuclei from white blood cells?
Nuclein, which is largely DNA.
What type of topoisomerase do bacteria have that is specifically mentioned?
DNA gyrase.
How does DNA gyrase affect positive supercoiling?
It relaxes positive supercoiling resulting from partial unwinding of a double helix.
What is the idealized version of DNA's structure called?
B-DNA.
What are the five main types of histones?
H1, H2A, H2B, H3, and H4.
What does the number 26 represent in this context?
It could refer to a quantity, age, or another numerical significance.
What are nucleosomes packed together to form?
Chromatin fibers and chromosomes.
What numerical value is associated with Figure 18 - 7?
What happens when relaxed circular DNA is twisted in the opposite direction?
It becomes negatively supercoiled.
What type of colonies does the S strain produce on solid agar medium?
Smooth and shiny colonies due to the mucous polysaccharide coat.
What is the more loosely packed form of chromatin known as?
Euchromatin.
What do regulatory proteins need to do to recognize specific base sequences in A-RNA?
They generally need to unwind the duplex.
What is the process of separating the two strands of a DNA molecule called?
DNA denaturation (melting).
What do R factors in E. coli carry?
Genes that impart drug resistance to the bacterial cell.
What is the significance of the date 9/29/2024?
It is a specific date that may hold importance in various contexts.
What date is associated with the reference to Figure 18-2?
September 29, 2024.
What are polytene chromosomes?
Specialized types of chromosomes not associated with cell division.
What is the process of converting relaxed circular DNA into supercoiled DNA?
Twisting it in the opposite direction creates negatively supercoiled DNA, while twisting in the same direction creates positively supercoiled DNA.
What happens to denatured DNA when the temperature is lowered?
It can be renatured (reannealed) as hydrogen bonds are reestablished.
What is a key feature of DNA related to its base pairing?
Denatured DNA can be renatured by lowering the temperature.
What are the names of the most studied T-even bacteriophages?
T2, T4, and T6.
From where did Miescher obtain the white blood cells for his experiments?
From pus found on surgical bandages.
What does the number 56 represent?
It could represent a quantity, age, or another numerical value depending on the context.
What is the length of DNA associated with the nucleosome core particle?
Approximately 146 base pairs (bp).
What happens when relaxed circular DNA is twisted in the same direction as the double helix?
It becomes positively supercoiled.
What characteristic distinguishes the R strain colonies from the S strain colonies?
R strain colonies exhibit a rough boundary due to the lack of a mucous coat.
What are two common chemical modifications of histone tails?
Addition or removal of acetyl and methyl groups.
What method did Chargaff use to analyze the four bases in DNA?
Chromatographic methods.
What is the function of the protein tail of a phage?
To attach to a bacterium and inject DNA.
What is the length range of minisatellite DNA?
About 102 to 105 bp.
What do type I topoisomerases do to relax supercoiled DNA?
Introduce transient single-strand breaks in DNA.
How can DNA be commonly denatured in the laboratory?
By raising either the temperature or the pH.
What is negative supercoiling associated with?
Unwinding of the double helix, which increases access to proteins involved in DNA replication or transcription.
What is the primary function of telomeres during replication?
To protect chromosomes from degradation at their vulnerable ends.
What is the date mentioned?
September 29, 2024.
What date is associated with the entry '9 / 29 / 2024'?
September 29, 2024.
Who was the British physician that provided background for Avery's work?
Frederick Griffith.
What bacterium did Griffith study?
Pneumococcus, now known as Streptococcus pneumoniae.
What was the initial reaction to assigning a genetic role to DNA?
It was not immediately accepted.
What happens to DNA from ruptured bacterial cells?
It forms a series of loops that remain attached to a structural framework.
What do chemical modifications of histones promote?
The binding of additional proteins to DNA associated with 'open' or 'closed' chromatin.
What conclusion did Griffith reach regarding the R strain and S strain bacteria?
Nonpathogenic R bacteria were converted into pathogenic S bacteria by a substance from heat-killed S bacteria.
What is contained within the head of the phage?
DNA.
Is supercoiling restricted to circular DNA?
No, but it is easiest to study in circular DNA molecules.
What is acetylation in the context of histone structure?
The addition of acetyl groups to amino acid side chains.
What factors affect the time required for DNA reassociation?
DNA concentration in the solution and the number of unique sequences within the DNA strands.
What is facultative heterochromatin?
Heterochromatin that can be converted to euchromatin and vice versa.
What is required for DNA gyrase to generate supercoiling?
ATP.
What is chromatin?
DNA bound to proteins in eukaryotic cells.
What general rule do some viruses violate regarding genetic material?
That double-stranded DNA is the only carrier of genetic information.
What numerical value is associated with the date?
What date is associated with the figure mentioned?
September 29, 2024.
What is a prophage?
A phage that is replicated along with bacterial DNA and remains inactive or repressed.
What happens to prophage DNA under certain conditions?
It is excised from the bacterial chromosome and enters a lytic cycle.
What is a nucleoid?
A distinct region in a bacterial cell where the bacterial chromosome resides.
Why is A-RNA not well suited for base recognition by RNA-binding proteins?
Because A-RNA has a narrower major groove.
What do Chargaff's rules imply about purines and pyrimidines?
The number of purines is equal to the number of pyrimidines (A + G = C + T).
What two kinds of molecules make up the T2 virus?
DNA and protein.
What are variable number tandem repeats (VNTRs)?
Shorter regions of tandemly repeated DNA.
What gives chromatin fibers their 'beads-on-a-string' appearance?
Nucleosomes attached by thin filaments of DNA.
What effect does histone methylation have on nucleosome packing?
It favors tighter packing.
What is the DNA melting temperature (Tm)?
The temperature at which one-half of the absorbance change has been achieved, or the thermal midpoint of denaturation.
What do the 'beads' in the 'beads-on-a-string' model consist of?
Proteins, presumably histones.
What is the purpose of extensive supercoiling during cell division?
To make the DNA more compact.
What do the thin filaments connecting the beads correspond to?
DNA.
What is the significance of the date 9/29/2024?
It appears to be a specific date, possibly indicating an event or deadline.
What are plasmids?
Relatively small, usually circular molecules of DNA that carry genes for their own replication and often for nonessential cellular functions.
What does proper base pairing in DNA strands affect?
It leads to a higher melting temperature.
Where is the bacterial chromosome localized within the cell?
In a special region called the nucleoid.
What are segments of chromatin that appear as dark spots in micrographs called?
Heterochromatin.
What is Chargaff's most striking observation about DNA?
The number of adenines is equal to the number of thymines (A = T), and the number of guanines is equal to the number of cytosines (G = C).
What alleviated doubts about DNA being the genetic material?
It was shown to be the genetic material of the bacteriophage T2.
Is heterochromatin transcriptionally active or inactive?
Transcriptionally inactive.
What effect does histone acetylation have on nucleosome packing?
It favors looser packing of nucleosomes.
What type of domains do proteins that associate with methylated histones have?
Chromodomains.
What are SINEs?
Short interspersed nuclear elements that consist of short repeated sequences less than 500 bp in length and do not contain genes.
What does DNA gyrase do to promote strand separation?
It actively introduces negative supercoils.
How do SINEs move within the genome?
They rely on enzymes made by other mobile elements for their movement.
What is the diameter of isolated chromatin fibers exhibiting the beads-on-a-string appearance?
About 10 nm.
What is the significance of the date 9/29/2024?
It is a specific date that may hold importance for events or deadlines.
What type of DNA molecules are shown in Figure 18 - 6 b?
Circular DNA molecules from bacteriophage PM 2.
What does the number '24' refer to in the context of Figure 18-3?
It may indicate a specific detail or reference point within the figure.
What are bacteriophages?
Viruses that infect bacteria.
How does the melting temperature of DNA change with increasing G + C content?
It increases.
What components make up a histone octamer?
Two H2A-H2B dimers and two H3-H4 dimers.
What is the maximum number of sequential repetitions of the GTTAC unit in the genome?
Several hundred thousand.
What are the two forms of the bacterium studied by Griffith?
S strain and R strain.
Where else can circular DNA molecules be found besides viruses?
In bacteria, mitochondria, and chloroplasts.
What characterizes DNA and RNA in terms of size?
They can be characterized by the number of base pairs.
What enzyme adds acetyl groups to histone molecules?
Histone acetyltransferase (HAT).
What role do hydrogen bonds play in DNA structure?
They stabilize the DNA and account for the specificity of base pairing across the double helix.
What are the most common SINEs in humans called?
Alu sequences.
How are VNTRs useful in medical forensics?
They help identify individuals with particular genetic constitutions.
What does methylation of lysine 4 in histone H3 indicate?
It is a hallmark of most active genes.
What effect does negative supercoiling have on DNA strands?
It gives the strands increased access to proteins involved in DNA replication or transcription.
What did Hershey and Chase conclude about the function of DNA?
DNA must function as the genetic material of phage T2.
What is the significance of Figure 18-2?
The content of Figure 18-2 is not provided, so its significance cannot be determined.
What does the number '6' refer to in the context of Figure 18-2?
The context of '6' is not provided, so its meaning cannot be determined.
What is the structural unit of chromatin?
Nucleosomes.
What is the significance of chromatin fibers?
They play a crucial role in packaging DNA into chromosomes.
How is the length of DNA measured?
In base pairs (bp).
What is indicated by the relationship between Tm and G + C content?
It shows that DNA samples from various sources have different thermal denaturation midpoints based on their base composition.
In which type of DNA was supercoiling first identified?
In the DNA of certain small viruses containing circular DNA molecules.
Can RNA be measured in the same way as DNA?
Yes, RNA is often measured using the same terminology.
How many years later was DNA confirmed as the genetic material of a virus?
Eight years later.
What type of DNA sequences are present in multiple copies per genome in eukaryotic chromosomes?
Repeated DNA sequences.
What two types of radioactive labeling did Hershey and Chase use in their experiment?
They labeled phage proteins with 35S and phage DNA with 32P.
What is euchromatin associated with?
DNA that is being actively transcribed.
When does supercoiling occur in linear DNA molecules?
When DNA is packaged into chromosomes during cell division.
What do bromodomains bind to?
Acetylated DNA associated with 'open' chromatin.
What is the significance of the overall pattern of histone modifications?
It leads to changes in the activity of the associated DNA, known as the 'histone code.'
What are the most important alternative forms of DNA?
Z-DNA and A-DNA.
What does the number 7 represent in various contexts?
It can represent a quantity, a lucky number, or have cultural significance.
What is the significance of the date 9/29/2024?
It is a specific date that may hold importance depending on the context.
What is the date mentioned in Figure 18 - 7?
September 29, 2024.
What is the most common arrangement of bacterial chromosomes?
A single circular DNA molecule bound to small amounts of protein.
Do plasmids replicate independently?
Yes, plasmids replicate autonomously with the replication of the bacterial chromosome.
What is supercoiled DNA?
DNA that has been twisted upon itself, forming a compact structure.
What is the consequence of imperfect base pairing in DNA?
It results in a lower melting temperature.
What is a key feature of the DNA structure regarding its strands?
The two strands are twisted around each other, creating a major groove and a minor groove.
What did Chargaff demonstrate about the percentage of bases in DNA from different cells of the same species?
The percentage of each of the four bases is the same.
What are transposable elements also known as?
Jumping genes.
What percentage of 32P remained with the bacterial cells?
65%.
What type of chromatin is prevalent in metabolically active cells?
Euchromatic.
How can A-DNA be created?
By dehydrating B-DNA.
What percentage of 35S was released into the surrounding medium?
80%.
What happens to chromatin as a cell prepares to divide?
All of its chromatin becomes highly compacted.
What is base stacking in DNA?
A major interaction within each of the single strands that stabilizes the DNA double helix.
What is the association of most histone acetylation?
It is associated with genes that are actively expressed or poised for expression.
What is the sequence found in human telomeres?
TTAGGG, with 250 – 1500 copies.
What is the next level of chromatin packaging after the 30-nm fiber?
Folding of the 30-nm fibers into DNA loops averaging 50,000 – 100,000 bp in length.
Why is it called satellite DNA?
Because its distinctive base composition causes it to appear in a 'satellite' band during centrifugation.
What is the date mentioned?
September 29, 2024.
What does the number 62 represent?
It is unclear without additional context.
What is the significance of Figure 18-3?
It likely illustrates a specific concept or data relevant to the topic discussed.
What does the number 61 represent in this context?
It is unclear without additional context; it could refer to a quantity, age, or another identifier.
What is the significance of Table 18-1?
It likely contains important data or information relevant to a specific topic.
What is indicated by the presence of negative supercoils in DNA?
It suggests a certain level of torsional strain in the DNA structure.
What type of chromosomes can bacteria have?
Single or multiple, circular or linear chromosomes.
What do the chromatin loops in polytene chromosomes contain?
Active regions of DNA that are being transcribed.
How many plasmids can a bacterial cell contain?
One or more plasmids.
What does the number '29' represent in this context?
It could refer to a specific entry or data point in Table 18-1.
Why is active DNA less tightly packed than inactive DNA?
To allow easier access by proteins involved in gene transcription.
What does the melting temperature (Tm) of DNA depend on?
The G + C content of the DNA.
Which bacterium is commonly infected by T-even phages?
Escherichia coli.
What is a key structural difference between A-type and B-type helices?
A-type helices have a wider minor groove and a narrower major groove than B-type helices.
What does the lytic cycle produce?
Progeny phage particles and lyses the host cell.
What disease is caused by the pathogenic strain of pneumococcus?
Fatal pneumonia in animals.
What is a kilobase (kb) in terms of base pairs?
1000 base pairs (bp).
What structure does the DNA double helix form around?
The histone octamer.
Which bacteriophage is one of the most thoroughly studied that infects E. coli?
Bacteriophage T2.
What do Chargaff's Rules state about the base pairing in DNA?
Adenine (A) pairs with Thymine (T) and Guanine (G) pairs with Cytosine (C).
What are F factors in E. coli?
Plasmids involved in the process of conjugation, a sexual process.
What was the purpose of the Hershey and Chase experiment in 1952?
To determine which molecule carries genetic information to make new phage particles.
What shape is the head of a T-even phage?
Hollow icosahedron (a 20-sided object).
What is one function of DNA gyrase?
It can induce and relax supercoiling.
What happens to native (double-stranded) DNA when heated slowly?
It 'melts' over a narrow temperature range, increasing absorbance at 260 nm.
What is the predominant carrier of genetic information?
Double-stranded DNA.
What is the biological significance of Z-DNA?
Not well understood, but it may play a role in activating gene expression.
What term did Griffith use to describe the conversion of R strain to S strain?
Genetic transformation.
What is the orientation of the two DNA strands?
They have an antiparallel orientation.
What is a common type of virus that carries RNA as genetic material?
Tobacco mosaic virus (TMV).
What is indicated by an increase in absorbance at 260 nm during DNA denaturation?
The melting of double-stranded DNA.
What effect does histone acetylation have on chromatin?
It promotes chromatin decondensation, leading to 'open' chromatin.
What types of supercoils can both type I and type II topoisomerases remove?
Both positive and negative supercoils.
What is referred to as a nucleosome?
Each bead along with its associated short stretch of DNA.
Why is Z-DNA named so?
Because of the zigzag pattern of its sugar-phosphate backbone.
What is the optimal tilt angle of the DNA backbone for base stacking?
30 degrees.
What are the two main categories of repeated DNA classified by researchers?
Tandemly repeated DNA and interspersed repeated DNA.
What direction does the DNA helix curve?
Right-handed, curving 'upward' to the right.
Why is the diameter of the DNA helix significant?
It's too small for two purines and too great for two pyrimidines, but accommodates a purine and a pyrimidine.
What enzymes catalyze the interconversion between relaxed and supercoiled forms of DNA?
Topoisomerases.
What is the reverse process of DNA denaturation that reestablishes a double helix?
DNA renaturation (reannealing).
How does supercoiling influence DNA?
By affecting both the spatial organization and the energy state of DNA, which impacts its ability to interact with other molecules.
Which bases pair together in DNA?
Adenine (A) pairs with Thymine (T) and Guanine (G) pairs with Cytosine (C).
What type of bonds join nucleotides in DNA?
Phosphodiester bonds.
What does the base sequence of one DNA chain determine?
The base sequence of the opposing chain.
What do chromatin remodeling proteins do?
They alter the position of nucleosomes along DNA.
Does DNA gyrase require ATP to relax an already supercoiled molecule?
No, it does not require ATP for that.
What conclusion did Hershey and Chase reach regarding genetic material?
DNA, not protein, had been injected into the bacterial cells.
What are cryptic plasmids in E. coli?
Plasmids with no known function and only the genes needed for replication and spread.
What amino acids are abundant in histones?
Lysine and arginine.
How can regulatory proteins influence DNA activity?
By recruiting complexes that contain enzymes like HAT and HDAC.
What is the relationship between histone acetylation and gene activity?
Histone acetylation is positively correlated with gene activity.
What is the role of SWI/SNF remodelers in chromatin remodeling?
They couple changes in histones with chromatin remodeling.
What happens to double-stranded DNA when the temperature is raised?
It denatures into single strands.
What is the Tm for the sample shown?
About 87 °C.
What is lytic growth characteristic of?
A virulent phage.
Where do regulatory proteins often bind in the DNA structure?
To the major groove, recognizing specific base sequences without unfolding the DNA double helix.
What is the function of col factors in E. coli?
They allow the bacterium to secrete colicins, which kill other bacteria lacking the col factor.
What element is found in the proteins of the T2 virus but not in its DNA?
Sulfur.
What type of bonds hold the two strands of a DNA double helix together?
Relatively weak, noncovalent bonds.
What is tandemly repeated DNA?
DNA where multiple copies are arranged next to each other in a row.
What is one type of tagging reaction that involves histones?
Methylation of the amino acid lysine via histone methyltransferase.
What percentage of a typical mammalian genome is made up of tandemly repeated DNA?
10 – 15%.
What is a key characteristic of Z-DNA?
It is a left-handed double helix.
What is the relationship between histone modifications and chromatin structure?
Histone modifications influence whether chromatin is 'open' or 'closed'.
What is the significance of the sugar-phosphate backbone in viral DNA?
It contains phosphorus, which helps distinguish DNA from protein.
Which bacteria does bacteriophage lambda infect?
E. coli cells.
What type of DNA accounts for surprisingly little of the human genome?
DNA that encodes proteins or gives rise to ribosomal or transfer RNAs, found in exons.
What maintains the spatial arrangement of the DNA loops?
Periodic attachment of DNA to a chromosomal scaffold formed by nonhistone proteins.
What is the basic unit of chromatin structure?
Nucleosomes.
What are Chargaff's rules?
A = T and G = C, indicating specific base pairing in DNA.
How are topoisomerases classified?
As either type I or type II.
Where are telomeres located?
At the tips of chromosomes.
What does the combination of tags on histones create?
A histone code that signals modifications of chromatin structure and gene activity.
What are microsatellite DNA or short tandem repeats (STRs)?
Even shorter repeats, about 10 – 100 bp in length, with repeat units of 1 – 10 bp.
What do type II topoisomerases do to relax supercoiled DNA?
Introduce transient double-strand breaks.
Under what conditions does A-DNA exist in significant amounts?
A-DNA does not exist in significant amounts under normal cellular conditions.
What does the DNA of a temperate phage in the integrated state called?
Prophage.
What observation did Chargaff make regarding the amounts of bases in DNA?
DNA molecules contain equal amounts of A and T, and equal amounts of G and C.
What was highly repetitive tandemly repeated DNA originally called?
Satellite DNA.
What effect do SWI/SNF remodelers have on DNA?
They make regions of DNA more accessible.
Do all vertebrates have the same telomere sequence?
Yes, all studied vertebrates have the same sequence.
What occurs when the solution of DNA is allowed to cool after heating?
The separated DNA strands reassociate by random collisions and then 'zip up' complementary base pairs.
What is the function of the protruding tail on histone molecules?
It can be tagged by the addition of methyl, acetyl, phosphate, or other groups.
What is the result of lytic growth?
Lysis of the host cell and production of many progeny phage particles.
How many copies of nonrepeated DNA sequences are present per genome?
One copy.
What influences the exact shapes and dimensions of B-DNA double helices?
The local nucleotide sequence.
What can a temperate phage do?
Produce lytic growth or integrate its DNA into the bacterial chromosome.
What percentage of the human genome consists of mobile elements?
Roughly half.
What type of DNA sequences do telomeres contain?
Highly repetitive DNA sequences.
How are the phosphodiester bonds oriented in the two DNA strands?
They are oriented in opposite directions.
What are histones?
A group of relatively small proteins that play a crucial role in chromatin structure.
What role do chromatin remodeling proteins play in relation to nucleosomes?
They can cause sliding of DNA within nucleosomes, exposing regions of DNA for gene activation.
How long are LINEs typically?
6000 – 8000 bp.
Which dinucleotides have the greatest base stacking energies?
GC dinucleotides.
What anchors the ends of each loop in bacterial DNA?
Structural components within the nucleoid.
What is the composition of the bacterial chromosome?
Supercoiled DNA bound to small, basic proteins, folded into looped domains.
What is measured to indicate the denaturation of DNA?
An increase in absorbance of light at 260 nm.
What holds the two strands of DNA together?
Hydrogen bonding between the bases in opposite strands.
What type of genetic material do some bacteriophages carry?
Single-stranded DNA.
What type of helix is A-DNA?
A right-handed helix that is shorter and thicker than B-DNA.
How does DNA packaging in eukaryotes differ from that in bacteria?
DNA packaging in eukaryotes is more complicated due to larger amounts of DNA and greater structural complexity.
What is positive supercoiling?
It involves tighter winding of the double helix, reducing opportunities for interaction.
What role does facultative heterochromatin play during embryonic development?
It may inactivate entire blocks of genes.
How do chromatin remodeling proteins function?
They couple ATP hydrolysis to changes in the organization and position of nucleosomes.
What is associated with gene silencing in histones?
Methylation of lysines 9 and 27.
What percentage of the human genome do LINEs account for?
Roughly 20%.
What additional role do telomeres play besides replication?
They recruit proteins involved in structural protection of chromosome tips.
Do other eukaryotes have similar telomere sequences?
Yes, including unicellular eukaryotes.
What effect does nicking the DNA with a topoisomerase have?
It relaxes the supercoiling without disrupting the loops.
What is the melting temperature (Tm) of DNA?
The temperature at which the midpoint of absorbance increase occurs during denaturation.
Does the percentage of DNA bases vary with individual, tissue, age, nutritional state, or environment?
No, it does not vary.
What do virulence factors enhance in E. coli?
The ability to cause disease by producing toxic proteins or enzymes that allow entry into host cells.
What do most protein-coding genes consist of?
Nonrepeated DNA.
What element is found in the DNA of the T2 virus but not in its proteins?
Phosphorus.
What is an example of a well-studied temperate phage?
Bacteriophage lambda (λ).
Which amino acids in the T2 virus proteins contain sulfur?
Methionine and cysteine.
How long are Alu sequences typically?
About 300 bp in length.
What are two important types of constitutive heterochromatin?
Centromeres and telomeres.
What roles do nonhistone proteins play in chromatin?
They play various enzymatic, structural, and regulatory roles.
Which proteins stabilize the base of the DNA loops in mammals?
Cohesin and CTCF.
How is the DNA of the bacterial chromosome structured?
It is negatively supercoiled and folded into loops averaging about 20,000 bp in length.
What are the sugar-phosphate backbones of the DNA strands positioned?
On the outside of the helix.
What is the relative abundance of histones in chromatin?
Roughly equal numbers of H2A, H2B, H3, and H4, with about half that number of H1.
Which important protein has bromodomains and is associated with gene transcription?
The transcription factor TFIID.
What is the diameter of the 30-nm chromatin fiber?
About 30 nm.
What is constitutive heterochromatin?
Heterochromatin that is permanently compacted and serves a structural function.
How does base stacking occur?
Through interactions between adjacent aromatic rings in organic compounds via hydrophobic and van der Waals interactions.
What percentage of the human genome do Alu sequences account for?
Approximately 10%.
What is the typical length range of the repeated unit in satellite DNA?
From 1 to 2000 base pairs (bp).
What effect do adjacent GC dinucleotides have on DNA?
They tend to stabilize its shape.
What do metabolic plasmids produce in E. coli?
Enzymes required for certain metabolic reactions.
How constant are the proportions of histones among different eukaryotic cells?
They are remarkably constant regardless of cell type or physiological state.
Is all nonrepeated DNA involved in encoding proteins?
No, not all nonrepeated DNA encodes proteins.
What is the function of histone deacetylase (HDAC)?
It removes acetyl groups from histones.
Why do histones bind to DNA?
Histones have a strong positive charge that stabilizes their binding to negatively charged DNA through ionic bonds.
What forms a threadlike mass of fibers in bacterial DNA?
The bacterial chromosome in the nucleoid region.
What do LINEs code for?
Enzymes involved in copying LINE sequences and inserting copies elsewhere in the genome.
What is the common length of the repeated unit in satellite DNA?
Shorter than 10 bp.
What do the bases in the DNA double helix do?
Face inward toward the center, forming the 'steps' of the 'circular staircase'.
What are the most abundant transposable elements in humans called?
LINEs (long interspersed nuclear elements).
What are the two types of tandemly repeated DNA mentioned?
Centromeric and telomeric DNA.
What type of double helices are most RNA structures?
Most RNA double helices are of the A type.
What happens when lysine 27 is methylated?
It leads to the recruitment and activation of enzymes that methylate adjoining DNA, coupling gene silencing alterations.
How do SWI/SNF remodelers interact with histones?
They have domains that bind the acetylated tails of histone proteins.
Give an example of a simple-sequence repeated DNA.
Built from the five-base unit GTTAC: . . . GTTACGTTACGTTACGTTACGTTAC . . .
How much does the DNA helix advance per nucleotide pair?
0.34 nm.
What is the diameter of the DNA helix?
2 nm.
What does it mean for the two chains of the DNA double helix to be complementary?
The base sequence of one chain determines the base sequence of the other chain.
What larger group of viruses carries their genetic material as RNA?
A much larger group of viruses compared to those with single-stranded DNA.
What role does histone H1 play in chromatin structure?
It facilitates the packing of nucleosomes into the 30-nm fiber.
What is the SWI/SNF family?
An important class of remodelers that slide nucleosomes or eject them from chromatin.
How does Z-DNA compare in size to B-DNA?
Z-DNA is longer and thinner than B-DNA.
What is the relationship between the mass of histones and DNA in chromatin?
In most cells, the mass of histones is approximately equal to the mass of DNA.
How many nucleotide pairs are there per turn of the DNA helix?
Ten nucleotide pairs.
What are the free ends of the first and last nucleotides in a DNA strand?
The first nucleotide has a free 5' end, and the last nucleotide has a free 3' end.
What additional proteins are found in chromatin besides histones?
A diverse group of nonhistone proteins.
What type of DNA is virtually all present in bacterial cells?
Nonrepeated DNA.
How long has the TTAGGG sequence been conserved?
Over hundreds of millions of years of evolution.
What structure did Watson and Crick discover DNA to be?
A double helix.
What is the length added to the DNA molecule with each complete turn of the helix?
3.4 nm.
How do eukaryotes differ from bacteria in terms of DNA repetition?
Eukaryotes exhibit large variations in their amounts of repeated versus nonrepeated DNA.
In which regions does Z-DNA most readily arise?
In DNA regions with alternating purines and pyrimidines or cytosines with extra methyl groups.
What role do RNAs and proteins play in bacterial DNA structure?
They help hold the loops in place.
